Advances in Analyzing Tandem Repeats in DNA
A look at tools for studying complex DNA sequences and their biological significance.
― 7 min read
Table of Contents
Biological sequences are intricate and contain various patterns. One of the most easily seen patterns is called Tandem Repeats. These are regions where a specific segment of DNA is repeated one after another. For example, a sequence like "AACAACAACAACA" contains the "AAC" unit repeated several times. When these repeats are clear, they are simple to spot. However, as they get old and change due to Mutations, they can become harder to recognize. For example, a sequence like "AACAACAATATCAATAACAACAACAGCAAC" might have originally been a clear repeat but has since changed enough that it's not so obvious anymore. Other changes like insertions or deletions can make it even tougher to identify these patterns.
There are different kinds of tandem repeats based on how long the repeating units are. Short tandem repeats are caused mainly by a process during DNA copying and have small units, generally ranging from 1 to 6 base pairs. These can repeat thousands of times, while minisatellites are larger, with units from 6 to 60 base pairs and can cover more space in the genome. The largest types, known as satellite repeats, can stretch for millions of base pairs. There’s even a special kind of higher order repeat, which is made up of complex patterns of the smaller satellite repeats.
Scientists have been interested in studying tandem repeats because they have several roles in biology. They contribute to how proteins and RNA work, help regulate genes, impact centromeres and telomeres, and are linked to certain genetic diseases.
Challenges in Analyzing Tandem Repeats
Tandem repeats have caused issues for scientists, especially when assembling DNA. This is because the repeating regions can be longer than the pieces of DNA that older sequencing methods could read. Thankfully, there have been major advancements in sequencing technology that allow for the reading of longer sections of DNA, making it easier to analyze complex regions like centromeric satellite DNA.
However, even with improved technology, tandem repeats still create significant challenges in analysis. Tools used to find related sequences, like BLAST or HMMER, compare sequences to estimate if they are evolutionarily connected. These tools expect to find certain levels of similarity purely by chance, but tandem repeats occur so much more often than they predict, leading to a lot of incorrect results. For instance, if you take a short repeat like "ATATATAT", you would generally expect to see it appear at a rate similar to winning the lottery. But in reality, there are hundreds of instances of it in the human genome. Most of these instances are not connected by ancestry; they are merely coincidentally similar because of how often they repeat.
When searching for sequences, finding false matches can happen even with patterns that are not perfect repeats. Even damaged or altered patterns can still show high scores in these searches, leading to further misinterpretation.
Reducing Errors from Tandem Repeats
One common technique to reduce errors caused by tandem repeats is Masking. This means hiding the parts of the sequence that are repetitive to improve the accuracy of downstream analysis. In hard-masking, a tool identifies the repetitive sections and replaces them with an ambiguous letter, like "N" for DNA, making it easier to ignore them in later analysis.
An alternative method called soft-masking marks repeats without hiding them entirely. In this case, the repetitive sequences are shown in lowercase, so some tools skip over them while looking for alignment but still use them when finalizing sequences.
The challenge with both methods is determining how much of the sequence to mask. If the threshold is too low, too much is masked, which can reduce the sensitivity of the analysis. If it’s too high, not enough is masked, which can allow unreliable repeats to create false results. Some suggest not masking at all and instead incorporating better models of repetitiveness directly into the annotation process. This would allow for more accurate scoring without eliminating useful information.
Tools for Identifying Tandem Repeats
There are many tools available for finding tandem repeats, each with its own strengths and weaknesses. Two notable ones are TRF and tantan.
TRF is widely used and first looks for well-conserved tandem repeat candidates. It then uses an algorithm to align them more accurately and provides labels that describe the repeat patterns and any mutations present.
Tantan operates based on a Hidden Markov Model and works quickly. It assigns scores to letters in a sequence to estimate how likely they are to be part of a tandem repeat. However, while it is fast and efficient, it may not give as detailed descriptions of repeats compared to TRF.
A newer tool called ULTRA is designed to improve sensitivity and specificity when identifying tandem repeats. It aims to produce meaningful score annotations and create a user-friendly experience.
How ULTRA Works
ULTRA works using a hidden Markov model to distinguish between repetitive and non-repetitive sequences. It has two categories: a single state for non-repetitive sequences and several states for different types of repetitive sequences. The non-repetitive state acts without context, while the repetitive states take into account previous letters, making it more accurate.
When there are mutations like substitutions, ULTRA adjusts the scores slightly. But when there are insertions or deletions, it can greatly affect the scores, leading to errors in identifying the overall pattern. ULTRA uses special states to account for these changes, ensuring that the overall pattern remains accurate despite the presence of indels.
When analyzing a long string of DNA, ULTRA uses the Viterbi algorithm to find the most likely arrangement of states that could have produced the observed string. This allows it to spot the most probable regions for tandem repeats.
After identifying repeats, ULTRA checks if there are changes in patterns through a repeat splitting process. This involves comparing sections of the repetitive sequences to see where changes happen, allowing it to accurately label these variations.
Score Distribution
Understanding theWhen using masking strategies, it’s essential to understand how scores are distributed in random sequences. By doing this, researchers can make informed decisions about which thresholds to use for determining which parts to mask or keep.
ULTRA's score distribution tends to show a smooth decay pattern, while other tools like TRF can produce chaotic distributions. This smooth progression helps in making reliable statistical estimates.
Performance of ULTRA
Tests have shown that ULTRA generally offers better coverage than other tools like TRF and tantan. While variations do exist based on the composition of the genomes being analyzed, ULTRA often produces fewer false positives, especially when it comes to genomes with large AT content.
When testing the ability of ULTRA to accurately identify and split repetitive sequences, it has shown to be most effective when the substitution rates are low. The tool is designed to report changes in patterns accurately, ensuring a clearer understanding of complex repeats.
Resource Consumption
When analyzing large genomes, the memory and time required for processing can be a concern. Compared to TRF and tantan, ULTRA has demonstrated reduced memory usage and faster processing, particularly because it can handle parallel computing effectively.
Conclusion
ULTRA is an exciting new tool for identifying and labeling tandem repeats in DNA. With its various features aimed at improving sensitivity and specificity, it has the potential to help researchers better understand the roles of these sequences in biology and reduce errors associated with them. The complex patterns found in tandem repeats continue to present challenges, but with tools like ULTRA, researchers can look forward to more accurate analyses and a deeper understanding of these important genetic sequences.
As research continues, there is hope that the work done with ULTRA will not only help clarify the nature of tandem repeats but also enhance our overall knowledge of genetic structures and their functions across various organisms.
Title: ULTRA-Effective Labeling of Repetitive Genomic Sequence
Abstract: In the age of long read sequencing, genomics researchers now have access to accurate repetitive DNA sequence (including satellites) that, due to the limitations of short read sequencing, could previously be observed only as unmappable fragments. Tools that annotate repetitive sequence are now more important than ever, so that we can better understand newly uncovered repetitive sequences, and also so that we can mitigate errors in bioinformatic software caused by those repetitive sequences. To that end, we introduce the 1.0 release of our tool for identifying and annotating locally-repetitive sequence, ULTRA (ULTRA Locates Tandemly Repetitive Areas). ULTRA is fast enough to use as part of an efficient annotation pipeline, produces state-of-the-art reliable coverage of repetitive regions containing many mutations, and provides interpretable statistics and labels for repetitive regions. It released under an open license, and available for download at https://github.com/TravisWheelerLab/ULTRA.
Authors: Travis J Wheeler, D. R. Olson
Last Update: 2024-06-04 00:00:00
Language: English
Source URL: https://www.biorxiv.org/content/10.1101/2024.06.03.597269
Source PDF: https://www.biorxiv.org/content/10.1101/2024.06.03.597269.full.pdf
Licence: https://creativecommons.org/licenses/by/4.0/
Changes: This summary was created with assistance from AI and may have inaccuracies. For accurate information, please refer to the original source documents linked here.
Thank you to biorxiv for use of its open access interoperability.